DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_027974c
Line Availability available from NASC (N685537) and ABRC (SALK_027974c)
Confirmed for Hit At4g25560
Parent of DUPLO pair 2498
Parent of pair(s) none

Gene hit At4g25560

 
Sequence (A. th genome BLAST matches underlined)
CAACAGCAACTGGACTCTTAACGACATTGTGTTTGGTTCCAAATGTAAGAAGCAGGAGCA
TCATATTTATAGAGAGGCTTCAGATTGTAATTCTTCTGCTGAATT
GenBank Accession BH758495 [GenBank]
Graphic View Graphic view of gene At4g25560
Predicted Position of Insertion Chr4:13053444 - go to primer design
BLAST e Value 2e-53
Hit Clone Code (BAC ID) M7J2
Hit Gene Code At4g25560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37