DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_028545
Line Availability available from NASC (N528545) and ABRC (SALK_028545)
Confirmed for Hit At2g26790
Parent of DUPLO pair none
Parent of pair(s) 807

Gene hit At2g26790

 
Sequence (A. th genome BLAST matches underlined)
GACCCAAATCTCGCTTTGTCGTTTTTGCGACAGCTTAAGGAACATGGTGTGTCCCCTAAT
GTCAATGCTTACGCAACTCTTGTCAGAATT
GenBank Accession BH753288 [GenBank]
Graphic View Graphic view of gene At2g26790
Predicted Position of Insertion Chr2:11427465 - go to primer design
BLAST e Value 1e-44
Hit Clone Code (BAC ID) F12C20
Hit Gene Code At2g26790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37