DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_029822c
Line Availability available from NASC (N678311) and ABRC (SALK_029822c)
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g09780

 
Sequence (A. th genome BLAST matches underlined)
GAAACAGTGAGGTTGGTCATAATGCTCTTGGTGCTGGTCGTATCTTTGCTCAAGGTGCTA
AGCT
GenBank Accession ED578084 [GenBank]
Graphic View Graphic view of gene At1g09780
Predicted Position of Insertion Chr1:3167508 - go to primer design
BLAST e Value 3e-29
Hit Clone Code (BAC ID) F21M12
Hit Gene Code At1g09780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphoglycerate mutase, 2,3-bisphosphoglycerate-independent
Insertion Classification CDSi
Confirmation Status failed


Last Updated on Thursday, 10 June 2021 13:37