DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_030147 |
Line Availability | available from NASC (N530147) and ABRC (SALK_030147) |
Confirmed for Hit | At5g18180 |
Parent of DUPLO pair | 998 |
Parent of pair(s) | none |
Gene hit At5g18180
Sequence (A. th genome BLAST matches underlined) | GCGATAAGTTCTTCATTAGCCCTGAGAAGCT |
GenBank Accession | BH749736 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:6008909 - go to primer design |
BLAST e Value | 4e-10 |
Hit Clone Code (BAC ID) | MRG7 |
Hit Gene Code | At5g18180 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Other FSTs Supporting this Hit | BH749736 [GenBank] |
Last Updated on Thursday, 10 June 2021 13:37 |