DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_030147
Line Availability available from NASC (N530147) and ABRC (SALK_030147)
Confirmed for Hit At5g18180
Parent of DUPLO pair 998
Parent of pair(s) none

Gene hit At5g18180

 
Sequence (A. th genome BLAST matches underlined)
GCGATAAGTTCTTCATTAGCCCTGAGAAGCT
GenBank Accession BH749736 [GenBank]
Graphic View Graphic view of gene At5g18180
Predicted Position of Insertion Chr5:6008909 - go to primer design
BLAST e Value 4e-10
Hit Clone Code (BAC ID) MRG7
Hit Gene Code At5g18180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH749736 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37