DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_031569
Line Availability available from NASC (N531569) and ABRC (SALK_031569)
Confirmed for Hit At5g66770
Parent of DUPLO pair 2582
Parent of pair(s) none

Gene hit At5g66770

 
Sequence (A. th genome BLAST matches underlined)
GAGTTGAGCGAGAGTTGTTCGGCCGGAGAATCTCGGGTTTGATTGGACCGGAGAAAACCG
GAATT
GenBank Accession ED579075 [GenBank]
Graphic View Graphic view of gene At5g66770
Predicted Position of Insertion Chr5:26662194 - go to primer design
BLAST e Value 7e-30
Hit Clone Code (BAC ID) MSN2
Hit Gene Code At5g66770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37