DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_031682c
Line Availability available from NASC (N654582) and ABRC (SALK_031682c)
Confirmed for Hit At5g20580
Parent of DUPLO pair 2799
Parent of pair(s) none

Gene hit At5g20580

 
Sequence (A. th genome BLAST matches underlined)
GGTCTCTGAGAGCTGAAACTTTCTTCCGCAGTTCAATATTTGATATTCTCTCCACCTCCA
GAGCTCGTTCAAGCTACACAATCCGTTGGTTTTGGTTTAGCCTCTCATAGTAAACAAAAG
GGTTTGAATT
GenBank Accession ED579140 [GenBank]
Graphic View Graphic view of gene At5g20580
Predicted Position of Insertion Chr5:6958807 - go to primer design
BLAST e Value 3e-68
Hit Clone Code (BAC ID) F7C8
Hit Gene Code At5g20580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TMEM192 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37