DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_032851c |
Line Availability | available from NASC (N657578) and ABRC (SALK_032851c) |
Confirmed for Hit | At3g21465 |
Parent of DUPLO pair | 1189 |
Parent of pair(s) | none |
Gene hit At3g21465
Sequence (A. th genome BLAST matches underlined) | ATGAGAAGAAGTCAGCACTTGAGGCTGAATT |
GenBank Accession | ED580021 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr3:7562911 - go to primer design |
BLAST e Value | 4e-10 |
Hit Clone Code (BAC ID) | MIL23 |
Hit Gene Code | At3g21465 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | adenylyl cyclase |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |