DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_032851c |
| Line Availability | available from NASC (N657578) and ABRC (SALK_032851c) |
| Confirmed for Hit | At3g21465 |
| Parent of DUPLO pair | 1189 |
| Parent of pair(s) | none |
Gene hit At3g21465
| Sequence (A. th genome BLAST matches underlined) | ATGAGAAGAAGTCAGCACTTGAGGCTGAATT |
| GenBank Accession | ED580021 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr3:7562911 - go to primer design |
| BLAST e Value | 4e-10 |
| Hit Clone Code (BAC ID) | MIL23 |
| Hit Gene Code | At3g21465 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | adenylyl cyclase |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 