DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_033579c
Line Availability available from NASC (N662053) and ABRC (SALK_033579c)
Confirmed for Hit At4g05450
Parent of DUPLO pair 9493
Parent of pair(s) none

Gene hit At4g05450

 
Sequence (A. th genome BLAST matches underlined) 
ACATTGTCTGCCTACACAATGCTGCCTTAATATTTTGCTGCTCTTTCTATTTCTTGTTTT
GGCAGAGGGATATTTAGCAACATACGGGACAAAGAATCTACACCGGTCTTATGGCCACTA
CTTGCAGTCTTTGGTTAGTCTGAGCTTGTTCTCGAGTTTTATACTCTCTTACAATCGATA
ATTTTGTTACTTCTTCATGTATAAACTCTCATTAA
GenBank Accession BH906495 [GenBank]
Graphic View Graphic view of gene At4g05450
Predicted Position of Insertion Chr4:2759241 - go to primer design
BLAST e Value 1e-119
Hit Clone Code (BAC ID) C6L9
Hit Gene Code At4g05450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitochondrial ferredoxin 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37