DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_033970c
Line Availability available from NASC (N665726) and ABRC (SALK_033970c)
Confirmed for Hit At1g14350
Parent of DUPLO pair 11672
Parent of pair(s) none

Gene hit At1g14350

 
Sequence (A. th genome BLAST matches underlined)
CAGCTCGCCTATTCAGGTCACGCCATTGTTCAGATCTTTGGCAGACGGTATACCAAGTCC
ACAGTTCTCCGAAAGTGTAAGCT
GenBank Accession ED580761 [GenBank]
Graphic View Graphic view of gene At1g14350
Predicted Position of Insertion Chr1:4910376 - go to primer design
BLAST e Value 2e-40
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14350 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Duplicated homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37