DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_035555c
Line Availability available from NASC (N656363) and ABRC (SALK_035555c)
Confirmed for Hit At5g04710
Parent of DUPLO pair 2179
Parent of pair(s) none

Gene hit At5g04710

 
Sequence (A. th genome BLAST matches underlined) 
AACATTCACCATGAGATAGCCAGACTTGGATGAAGCAGACTTCGGTTTAAGTTTAAGACA
CGGGCTATCGGTGTGAGCAGCTATGGCATGAAAACCATTACCAGGCACATACCTACAAAA
TGAGGAACAAATGTAGGTTCCCTGAACCCAACAAATAAGGAATCTAAGAAAG
GenBank Accession ED582855 [GenBank]
Graphic View Graphic view of gene At5g04710
Predicted Position of Insertion Chr5:1359366 - go to primer design
BLAST e Value 3e-93
Hit Clone Code (BAC ID) T1E3
Hit Gene Code At5g04710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Zn-dependent exopeptidases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED582855 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37