DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_036447c |
| Line Availability | available from NASC (N677687) and ABRC (SALK_036447c) |
| Confirmed for Hit | At4g02650 |
| Parent of DUPLO pair | none |
| Parent of pair(s) | 2735 |
Gene hit At4g02650
| Sequence (A. th genome BLAST matches underlined) | CTTGTCGTCCAACAGGTAATAATTA |
| GenBank Accession | BH906900 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr4:1157209 - go to primer design |
| BLAST e Value | 1e-06 |
| Hit Clone Code (BAC ID) | T10P11 |
| Hit Gene Code | At4g02650 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | ENTH/ANTH/VHS superfamily protein |
| Insertion Classification | CDSi |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 