DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_036476c
Line Availability available from NASC (N660813) and ABRC (SALK_036476c)
Confirmed for Hit At3g13730
Parent of DUPLO pair 2697
Parent of pair(s) none

Gene hit At3g13730

 
Sequence (A. th genome BLAST matches underlined)
GACGAGCCAAATCGAGACCAGGGCACAATCTCTGACCACCTCCAAAAGGACTGAAACTAC
TCGTGTTCATGTCCCTTTCCTATTTTGTGAAGAAATGAATTAAATATATAATTCGTATTA
AGTAAAAGATTATATGTTAAATATATTTTGGTGATCTTACGTACTTGCCATCTCCAGGGA
TTAAATTTGTAGGGAGACTCATAATAAAGCT
GenBank Accession ED584442 [GenBank]
Graphic View Graphic view of gene At3g13730
Predicted Position of Insertion Chr3:4498683 - go to primer design
BLAST e Value 1e-116
Hit Clone Code (BAC ID) MMM17
Hit Gene Code At3g13730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 90, subfamily D, polypeptide 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED584442 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37