DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_036792
Line Availability available from NASC (N536792) and ABRC (SALK_036792)
Confirmed for Hit At4g27680
Parent of DUPLO pair 2266
Parent of pair(s) none

Gene hit At4g27680

 
Sequence (A. th genome BLAST matches underlined)
ATCGGGAATCTTCTTCGGGATCCCGCTGCCATGAATCCTGAGATTCTGACTGTAGGTTAA
TGATCTGAGAAACTAGAAGCT
GenBank Accession ED584782 [GenBank]
Graphic View Graphic view of gene At4g27680
Predicted Position of Insertion Chr4:13823081 - go to primer design
BLAST e Value 3e-39
Hit Clone Code (BAC ID) T29A15
Hit Gene Code At4g27680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37