DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_038145c
Line Availability available from NASC (N665800) and ABRC (SALK_038145c)
Confirmed for Hit At3g50050
Parent of DUPLO pair 2411
Parent of pair(s) none

Gene hit At3g50050

 
Sequence (A. th genome BLAST matches underlined)
TGCTTCTTGTAGAATATAGTTTCTCGGTTTACAAATCATCAAATAAAGCT
GenBank Accession ED583430 [GenBank]
Graphic View Graphic view of gene At3g50050
Predicted Position of Insertion Chr3:18554495 - go to primer design
BLAST e Value 4e-21
Hit Clone Code (BAC ID) F3A4
Hit Gene Code At3g50050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic aspartyl protease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37