DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_039445c
Line Availability available from NASC (N662175) and ABRC (SALK_039445c)
Confirmed for Hit At5g20150
Parent of DUPLO pair 2293
Parent of pair(s) none

Gene hit At5g20150

 
Sequence (A. th genome BLAST matches underlined)
GTGATCTCATGCGTTTACCTTTCATCCAGAAAGTTCTTCAGCAACCTTTTTACACTACTG
ACTTATTGTTCAAGCT
GenBank Accession ED584169 [GenBank]
Graphic View Graphic view of gene At5g20150
Predicted Position of Insertion Chr5:6803033 - go to primer design
BLAST e Value 2e-36
Hit Clone Code (BAC ID) F5O24
Hit Gene Code At5g20150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SPX domain-containing protein 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37