DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_039817
Line Availability available from NASC (N539817) and ABRC (SALK_039817)
Confirmed for Hit At2g42310
Parent of DUPLO pair 939
Parent of pair(s) none

Gene hit At2g42310

 
Sequence (A. th genome BLAST matches underlined) 
GGGAGCTTACTTGCTACATCATCAACGTCCTTACTATTGTTATCCTCGGCGTTGGACTCA
ATGCCGCACCTGATCTATTCGTCGAGACTTGGGCTCATCAGAAAGCT
GenBank Accession BH754344 [GenBank]
Graphic View Graphic view of gene At2g42310
Predicted Position of Insertion Chr2:17625435 - go to primer design
BLAST e Value 5e-26
Hit Clone Code (BAC ID) MHK10
Hit Gene Code At2g42310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ESSS subunit of NADH:ubiquinone oxidoreductase (complex I) protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37