DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_041356c
Line Availability available from NASC (N658203) and ABRC (SALK_041356c)
Confirmed for Hit At3g02490
Parent of DUPLO pair 2415
Parent of pair(s) none

Gene hit At3g02490

 
Sequence (A. th genome BLAST matches underlined)
AGTAATCCATGAACGGGTCCACGAAAGGAGGGAACCCGTGATTTCTCATCATAGGTAGAA
GACTCAAAGCTGACTCNNCNTNATTTTGTATGTACTGTGCCTAGGTTTCAACTGATTTTG
TTTCACTAGCTCACTGAAAAGCT
GenBank Accession ED586472 [GenBank]
Graphic View Graphic view of gene At3g02490
Predicted Position of Insertion Chr3:515341 - go to primer design
BLAST e Value 5e-33
Hit Clone Code (BAC ID) F16B3
Hit Gene Code At3g02490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit ED586472 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37