DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_042026c
Line Availability available from NASC (N662223) and ABRC (SALK_042026c)
Confirmed for Hit At4g29790
Parent of DUPLO pair 1669
Parent of pair(s) none

Gene hit At4g29790

 
Sequence (A. th genome BLAST matches underlined)
CATGAAACAGCAGGTAAGTGGTTTTCCTGCATTTCGTAAGACAGTTAATACCCTTTAGAC
CTCATATCTGAAGGATGTGACAGATCATTTGTATATGTCTATTTCTTGAATCGTTGTATA
CCACTAATTATTACC
GenBank Accession BH907378 [GenBank]
Graphic View Graphic view of gene At4g29790
Predicted Position of Insertion Chr4:14587493 - go to primer design
BLAST e Value 7e-69
Hit Clone Code (BAC ID) F27B13
Hit Gene Code At4g29790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation serine/arginine repetitive matrix protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37