DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_042206c
Line Availability available from NASC (N662228) and ABRC (SALK_042206c)
Confirmed for Hit At4g33700
Parent of DUPLO pair 2536
Parent of pair(s) none

Gene hit At4g33700

 
Sequence (A. th genome BLAST matches underlined) 
GAGTTCCCTCACTATCCACATCCACTCGGGCTTCCTTAACACTCCCTATTAGAAACCAAA
GCAAAGATTCTCAATACTTGTAACTCAGCAAGACATTGTTTTGTCGATTAATGAAGCAGT
TTACCATTT
GenBank Accession ED586729 [GenBank]
Graphic View Graphic view of gene At4g33700
Predicted Position of Insertion Chr4:16176893 - go to primer design
BLAST e Value 1e-67
Hit Clone Code (BAC ID) T16L1
Hit Gene Code At4g33700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CBS domain protein (DUF21)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37