DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_042866c
Line Availability available from NASC (N662249) and ABRC (SALK_042866c)
Confirmed for Hit At1g06660
Parent of DUPLO pair 12051
Parent of pair(s) none

Gene hit At1g06660

 
Sequence (A. th genome BLAST matches underlined)
GCCTTGACAAAGAGAGATTTGATTTAGATTCTATACATATTGGACGAGGCCTTAGGGATG
AGGTATGATTTTTATT
GenBank Accession BH907532 [GenBank]
Graphic View Graphic view of gene At1g06660
Predicted Position of Insertion Chr1:2039561 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) F12K11
Hit Gene Code At1g06660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37