DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_042875c
Line Availability available from NASC (N670625) and ABRC (SALK_042875c)
Confirmed for Hit At3g66656
Parent of DUPLO pair 6867
Parent of pair(s) none

Gene hit At3g66656

 
Sequence (A. th genome BLAST matches underlined)
CTCCAGGAAACAAACCGTATTCCTTCGGGAAACCGAATTTTGATGTGATTGCAGAACGGT
TTAAGAATGAATT
GenBank Accession ED586999 [GenBank]
Graphic View Graphic view of gene At3g66656
Predicted Position of Insertion Chr3:2091653 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) T8E24
Hit Gene Code At3g66656 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 91
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37