DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_046675c
Line Availability available from NASC (N665933) and ABRC (SALK_046675c)
Confirmed for Hit At2g47460
Parent of DUPLO pair 2671
Parent of pair(s) none

Gene hit At2g47460

 
Sequence (A. th genome BLAST matches underlined)
AAGGGAATCTCGACTGTCTTCTTCAGTCTTGTCCATCGGTGGAGTCGTTTCTCAACTACG
ACCACCAA
GenBank Accession BH908239 [GenBank]
Graphic View Graphic view of gene At2g47460
Predicted Position of Insertion Chr2:19478953 - go to primer design
BLAST e Value 1e-31
Hit Clone Code (BAC ID) T30B22
Hit Gene Code At2g47460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 12
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37