DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_047557c
Line Availability available from NASC (N662366) and ABRC (SALK_047557c)
Confirmed for Hit At1g29820
Parent of DUPLO pair none
Parent of pair(s) 944, 92426

Gene hit At1g29820

 
Sequence (A. th genome BLAST matches underlined)
AAAGGAACCAATAATCCCATCAGTCCAAAGATCGCTCTTGGGAACACCTGAATGATTTTT
ACTCTCAAGCT
GenBank Accession BH749288 [GenBank]
Graphic View Graphic view of gene At1g29820
Predicted Position of Insertion Chr1:10438341 - go to primer design
BLAST e Value 1e-28
Hit Clone Code (BAC ID) F1N18
Hit Gene Code At1g29820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Magnesium transporter CorA-like family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37