DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_048606c
Line Availability available from NASC (N665974) and ABRC (SALK_048606c)
Confirmed for Hit At2g43280
Parent of DUPLO pair 12024
Parent of pair(s) none

Gene hit At2g43280

 
Sequence (A. th genome BLAST matches underlined) 
ATGACCCATTTGCCAGACCGGTCATACTTAACATGAATCATAGCTTTGCAACCTTCTCTT
GTACTCGGTCTAGGTTTCCTAACTGATCCAAACTTACCACGAATACTAACACAATGACCT
TCTTTGTTACAACCGAATCTCCGGGCAAGAATT
GenBank Accession BH755184 [GenBank]
Graphic View Graphic view of gene At2g43280
Predicted Position of Insertion Chr2:17990474 - go to primer design
BLAST e Value 6e-82
Hit Clone Code (BAC ID) F14B2
Hit Gene Code At2g43280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Far-red impaired responsive (FAR1) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37