DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_048982c
Line Availability available from NASC (N684834) and ABRC (SALK_048982c)
Confirmed for Hit At3g05200
Parent of DUPLO pair 2466
Parent of pair(s) none

Gene hit At3g05200

 
Sequence (A. th genome BLAST matches underlined)
GTACCACACGCCGGTGTTTCACCAGTTGGGGGAGCTAGATCCAGAGCAACCGTCTAACGC
GGCGGCGCGTGGTCTCCGAAGTTTCATTTGCCGAGACTTTTCCTAC
GenBank Accession BH755333 [GenBank]
Graphic View Graphic view of gene At3g05200
Predicted Position of Insertion Chr3:1477602 - go to primer design
BLAST e Value 8e-28
Hit Clone Code (BAC ID) T12H1
Hit Gene Code At3g05200 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37