DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_049590c |
Line Availability | available from NASC (N659858) and ABRC (SALK_049590c) |
Confirmed for Hit | At5g22400 |
Parent of DUPLO pair | 2476 |
Parent of pair(s) | none |
Gene hit At5g22400
Sequence (A. th genome BLAST matches underlined) | ATGGAGGAGAAGAAGACGATGGTGGGGAAG |
GenBank Accession | ED588884 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr5:7425109 - go to primer design |
BLAST e Value | 2e-09 |
Hit Clone Code (BAC ID) | MWD9 |
Hit Gene Code | At5g22400 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | Rho GTPase activating protein with PAK-box/P21-Rho-binding domain-containing protein |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |