DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_054203
Line Availability available from NASC (N554203) and ABRC (SALK_054203)
Confirmed for Hit At3g02500
Parent of DUPLO pair 985
Parent of pair(s) none

Gene hit At3g02500

 
Sequence (A. th genome BLAST matches underlined)
TCTAAGAAGTAATTAGCATCAAAAGAGGCTATTACCTTTGAGGGAGTAACCCGGAGAAGA
GGCAGTACTAGAGATGGTGACGTTTGTTGTACAAGACTTGCGGACTTCTCGGAAGCT
GenBank Accession BH756782 [GenBank]
Graphic View Graphic view of gene At3g02500
Predicted Position of Insertion Chr3:519591 - go to primer design
BLAST e Value 8e-56
Hit Clone Code (BAC ID) F16B3
Hit Gene Code At3g02500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mental retardation GTPase activating protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH756782 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37