DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_054337c
Line Availability available from NASC (N653212) and ABRC (SALK_054337c)
Confirmed for Hit At1g53730
Parent of DUPLO pair none
Parent of pair(s) 626, 3375, 44904, 85589

Gene hit At1g53730

 
Sequence (A. th genome BLAST matches underlined) 
CCAATGCTTTACTTTCCTCTTCTGATAAGTGTAAGAAGTCATGTAATGATCCATTTTTGT
GGAATTGANATTGNTCTTGCAGGTATCTGCATGAAGTTTGCTCACCGTCTATAGTGGACA
AGAATATCAAATCAGCTAATATTTTACTCGATTCAGAGCTGAATCCTCACTTATCAGATT
CTGGTCTCGCAAGCT
GenBank Accession BH790018 [GenBank]
Graphic View Graphic view of gene At1g53730
Predicted Position of Insertion Chr1:20064643 - go to primer design
BLAST e Value 6e-64
Hit Clone Code (BAC ID) F22G10
Hit Gene Code At1g53730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation STRUBBELIG-receptor family 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH790018 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37