DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_055721c
Line Availability available from NASC (N654660) and ABRC (SALK_055721c)
Confirmed for Hit At1g50960
Parent of DUPLO pair 12881
Parent of pair(s) none

Gene hit At1g50960

 
Sequence (A. th genome BLAST matches underlined) 
CTTTAGGACAAATTTCTGCTCGATTTTCGGAAGCTCATTTCCAAATTCAACTAGTGAGAG
CAATACAAACACATCAACTATCCAAACCTCAGGCATAAAGCTTCCTGTGATCGATCTCAG
CCATCTAACTAGTGGTGAGGAGGTCAAACGCAAAAGATGTGTGAAACAAATGGTTGCAGC
TGCGAAAGAGTGGGGATTTTTTCAAATTGTGAACCATGGAATT
GenBank Accession BH757215 [GenBank]
Graphic View Graphic view of gene At1g50960
Predicted Position of Insertion Chr1:18889566 - go to primer design
BLAST e Value 1e-121
Hit Clone Code (BAC ID) F8A12
Hit Gene Code At1g50960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation gibberellin 2-oxidase 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37