DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_057452
Line Availability available from NASC (N557452) and ABRC (SALK_057452)
Confirmed for Hit At4g17486
Parent of DUPLO pair 2345
Parent of pair(s) none

Gene hit At4g17486

 
Sequence (A. th genome BLAST matches underlined)
AACATGAGCTTGAGCTCAATGTAGGCACCCACATTTTACACACAATATCCCAATTCAAAG
TCACGATCGAACCATTCCTTTCTTCCTAAACCTCTGCAACACT
GenBank Accession BH790626 [GenBank]
Graphic View Graphic view of gene At4g17486
Predicted Position of Insertion Chr4:9751168 - go to primer design
BLAST e Value 3e-52
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17486 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PPPDE putative thiol peptidase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37