DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_058044c
Line Availability available from NASC (N662578) and ABRC (SALK_058044c)
Confirmed for Hit At3g13810
Parent of DUPLO pair none
Parent of pair(s) 2591

Gene hit At3g13810

 
Sequence (A. th genome BLAST matches underlined)
ATTATGAGTTGACCTCTCGTAGGCCGTGGTTGGTGGTAAAGGAGGTGTCTT
GenBank Accession BH790847 [GenBank]
Graphic View Graphic view of gene At3g13810
Predicted Position of Insertion Chr3:4546946 - go to primer design
BLAST e Value 1e-21
Hit Clone Code (BAC ID) MCP4
Hit Gene Code At3g13810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation indeterminate(ID)-domain 11
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37