DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_059686c
Line Availability available from NASC (N662631) and ABRC (SALK_059686c)
Confirmed for Hit At1g66180
Parent of DUPLO pair 2589
Parent of pair(s) none

Gene hit At1g66180

 
Sequence (A. th genome BLAST matches underlined)
GATCCATCTCTTTCTTCTTCTTTCTCAACTTTGCCTTGCTCACATCCTCTTTGTAAACCG
AGAATT
GenBank Accession ED591195 [GenBank]
Graphic View Graphic view of gene At1g66180
Predicted Position of Insertion Chr1:24647560 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) F15E12
Hit Gene Code At1g66180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic aspartyl protease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37