DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_060037c
Line Availability available from NASC (N657638) and ABRC (SALK_060037c)
Confirmed for Hit At1g72210
Parent of DUPLO pair 12169
Parent of pair(s) none

Gene hit At1g72210

 
Sequence (A. th genome BLAST matches underlined)
GGGTTAGTGGGTTGAATTTGCAAATTCAAATTAAATTGGTATCTAATAATTAA
GenBank Accession BH910523 [GenBank]
Graphic View Graphic view of gene At1g72210
Predicted Position of Insertion Chr1:27181556 - go to primer design
BLAST e Value 7e-23
Hit Clone Code (BAC ID) T9N14
Hit Gene Code At1g72210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37