DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_060839
Line Availability available from NASC (N560839) and ABRC (SALK_060839)
Confirmed for Hit At1g17450
Parent of DUPLO pair 11796
Parent of pair(s) none

Gene hit At1g17450

 
Sequence (A. th genome BLAST matches underlined)
TGATGATCTTCTAATGAATCTAGAAACTTCTCACTATTTGAGGCATCGATGGCATCGGAA
TT
GenBank Accession BH791687 [GenBank]
Graphic View Graphic view of gene At1g17450
Predicted Position of Insertion Chr1:5992394 - go to primer design
BLAST e Value 6e-21
Hit Clone Code (BAC ID) F1L3
Hit Gene Code At1g17450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation B-block binding subunit of TFIIIC
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37