DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_061079c
Line Availability available from NASC (N669760) and ABRC (SALK_061079c)
Confirmed for Hit At3g56850
Parent of DUPLO pair 7971
Parent of pair(s) none

Gene hit At3g56850

 
Sequence (A. th genome BLAST matches underlined)
AAATCCTCCCTAGTGTACCACCGCCGTGATCCCAATCGGCAG
GenBank Accession ED591673 [GenBank]
Graphic View Graphic view of gene At3g56850
Predicted Position of Insertion Chr3:21046624 - go to primer design
BLAST e Value 7e-07
Hit Clone Code (BAC ID) T8M16
Hit Gene Code At3g56850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABA-responsive element binding protein 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37