DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_062093c
Line Availability available from NASC (N669770) and ABRC (SALK_062093c)
Confirmed for Hit At1g34340
Parent of DUPLO pair 2688
Parent of pair(s) none

Gene hit At1g34340

 
Sequence (A. th genome BLAST matches underlined)
AAACCAACCATATTGGTAGTAAAATCAGTCACTAAAATCTTACCATCAGAATT
GenBank Accession ED593400 [GenBank]
Graphic View Graphic view of gene At1g34340
Predicted Position of Insertion Chr1:12531538 - go to primer design
BLAST e Value 7e-23
Hit Clone Code (BAC ID) F23M19
Hit Gene Code At1g34340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37