DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_062789
Line Availability available from NASC (N562789) and ABRC (SALK_062789)
Confirmed for Hit At1g15700
Parent of DUPLO pair 1487
Parent of pair(s) none

Gene hit At1g15700

 
Sequence (A. th genome BLAST matches underlined)
CTTTGCTCGTTAGCCTAAACATCTCATCCTCGATAGCATCAACACACT
GenBank Accession BH792131 [GenBank]
Graphic View Graphic view of gene At1g15700
Predicted Position of Insertion Chr1:5402949 - go to primer design
BLAST e Value 6e-20
Hit Clone Code (BAC ID) F7H2
Hit Gene Code At1g15700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATPase, F1 complex, gamma subunit protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37