DUPLOdb - Line and FST details
Line specific information
Line ID | SALK_062853c |
Line Availability | available from NASC (N686105) and ABRC (SALK_062853c) |
Confirmed for Hit | At2g33270 |
Parent of DUPLO pair | 11724 |
Parent of pair(s) | none |
Gene hit At2g33270
Sequence (A. th genome BLAST matches underlined) | TTGTTTTGTTTTTGCAGATAAGGAAATTCAAGGA |
GenBank Accession | BH792156 [GenBank] |
Graphic View | |
Predicted Position of Insertion | Chr2:14104933 - go to primer design |
BLAST e Value | 8e-12 |
Hit Clone Code (BAC ID) | F4P9 |
Hit Gene Code | At2g33270 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | atypical CYS HIS rich thioredoxin 3 |
Insertion Classification | CDSi |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on Thursday, 10 June 2021 13:37 |