DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_062853c
Line Availability available from NASC (N686105) and ABRC (SALK_062853c)
Confirmed for Hit At2g33270
Parent of DUPLO pair 11724
Parent of pair(s) none

Gene hit At2g33270

 
Sequence (A. th genome BLAST matches underlined)
TTGTTTTGTTTTTGCAGATAAGGAAATTCAAGGA
GenBank Accession BH792156 [GenBank]
Graphic View Graphic view of gene At2g33270
Predicted Position of Insertion Chr2:14104933 - go to primer design
BLAST e Value 8e-12
Hit Clone Code (BAC ID) F4P9
Hit Gene Code At2g33270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation atypical CYS HIS rich thioredoxin 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37