DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_063265c
Line Availability available from NASC (N670825) and ABRC (SALK_063265c)
Confirmed for Hit At4g16600
Parent of DUPLO pair 2625
Parent of pair(s) none

Gene hit At4g16600

 
Sequence (A. th genome BLAST matches underlined)
CATTTTATACATAATGCAAAAAAAATCTGTTTTGATCTTATTATAATTCATTAA
GenBank Accession BH792277 [GenBank]
Graphic View Graphic view of gene At4g16600
Predicted Position of Insertion Chr4:9351212 - go to primer design
BLAST e Value 4e-09
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-diphospho-sugar transferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BH792277 [GenBank]


Last Updated on Thursday, 10 June 2021 13:37