DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_063269c
Line Availability available from NASC (N662714) and ABRC (SALK_063269c)
Confirmed for Hit At3g57540
Parent of DUPLO pair 1399
Parent of pair(s) none

Gene hit At3g57540

 
Sequence (A. th genome BLAST matches underlined)
TCTCCTCTCCTCCGCCTTCCTCTTANCTTTTGCCGCTTTGGTTTGCGTTTTCTCCGTCGC
CTTCGCTCTCCGATCTTCCAG
GenBank Accession BH910924 [GenBank]
Graphic View Graphic view of gene At3g57540
Predicted Position of Insertion Chr3:21301737 - go to primer design
BLAST e Value 3e-23
Hit Clone Code (BAC ID) T8H10
Hit Gene Code At3g57540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Remorin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37