DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_063470c
Line Availability available from NASC (N660455) and ABRC (SALK_063470c)
Confirmed for Hit At2g35930
Parent of DUPLO pair 2386
Parent of pair(s) none

Gene hit At2g35930

 
Sequence (A. th genome BLAST matches underlined)
GGTGTGCCATAAGATACTTATGGTTTCACAGACAGCGACCCATACAGCGATTAAGGATTT
GTTGTCGG
GenBank Accession ED593918 [GenBank]
Graphic View Graphic view of gene At2g35930
Predicted Position of Insertion Chr2:15083368 - go to primer design
BLAST e Value 9e-08
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g35930 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant U-box 23
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37