DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_063593c
Line Availability available from NASC (N655088) and ABRC (SALK_063593c)
Confirmed for Hit At5g64640
Parent of DUPLO pair 2557
Parent of pair(s) none

Gene hit At5g64640

 
Sequence (A. th genome BLAST matches underlined) 
CACATGGTTTCTGACCCTACTGGAACCAGGGACAGTCTCATAATAATTCTATAGACATAC
ATAACTTGAATCTCAAAACTAAATAACAATAAATATTATTCTTTTTACGTGGCAGAGCAA
ATCTAGACACAGTAAAAGAAACAAGACAAATTTATGTTTTGACTTTAATGTTATTCTTCT
TATTTATGTTCCTTAATTAAATTAA
GenBank Accession BH910947 [GenBank]
Graphic View Graphic view of gene At5g64640
Predicted Position of Insertion Chr5:25838208 - go to primer design
BLAST e Value 1e-108
Hit Clone Code (BAC ID) MUB3
Hit Gene Code At5g64640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant invertase/pectin methylesterase inhibitor superfamily
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37