DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_064167c
Line Availability available from NASC (N656577) and ABRC (SALK_064167c)
Confirmed for Hit At1g02370
Parent of DUPLO pair 2424
Parent of pair(s) none

Gene hit At1g02370

 
Sequence (A. th genome BLAST matches underlined)
TTGTCCCTAAACTAAGTAATAAATGTGATTAGCACGTTATGTTTAAACTTGTGTCCCGTT
TAGAGTTTCCAGTTCCAGAAAACAAAGCT
GenBank Accession ED594460 [GenBank]
Graphic View Graphic view of gene At1g02370
Predicted Position of Insertion Chr1:476374 - go to primer design
BLAST e Value 5e-44
Hit Clone Code (BAC ID) T6A9
Hit Gene Code At1g02370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37