DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_064776c
Line Availability available from NASC (N653846) and ABRC (SALK_064776c)
Confirmed for Hit At3g14000
Parent of DUPLO pair none
Parent of pair(s) 2467, 96854, 96858

Gene hit At3g14000

 
Sequence (A. th genome BLAST matches underlined)
AACACACCTAAAGTCGCGAGACCCATCTGGTAAAGCTCTGATTGTGATGTGAACACCTGC
TTCGGCCTGTCCCGGCCATTCCGCATCAATGCCACTTGCATTACTTAAAGAATACTCCTC
CACTGAATGAGCTACTTCTT
GenBank Accession BH792601 [GenBank]
Graphic View Graphic view of gene At3g14000
Predicted Position of Insertion Chr3:4631340 - go to primer design
BLAST e Value 2e-26
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g14000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DZC (Disease resistance/zinc finger/chromosome condensation-like region) domain containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37