DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_065334c
Line Availability available from NASC (N662770) and ABRC (SALK_065334c)
Confirmed for Hit At5g13640
Parent of DUPLO pair 1872
Parent of pair(s) none

Gene hit At5g13640

 
Sequence (A. th genome BLAST matches underlined)
ATTGTAAACTCCTGCTTTCAGACAGCTATCTTCGTCCTCCTCGTGAGCAGAAGTGAATAT
CTGAAAGGGGATGCAACTGTCGGGAGACTGGTTAAGCT
GenBank Accession ED594967 [GenBank]
Graphic View Graphic view of gene At5g13640
Predicted Position of Insertion Chr5:4396904 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) T6I14
Hit Gene Code At5g13640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phospholipid:diacylglycerol acyltransferase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37