DUPLOdb - Line and FST details
Line specific information
| Line ID | SALK_065596c |
| Line Availability | available from NASC (N684877) and ABRC (SALK_065596c) |
| Confirmed for Hit | At5g16790 |
| Parent of DUPLO pair | 1900 |
| Parent of pair(s) | none |
Gene hit At5g16790
| Sequence (A. th genome BLAST matches underlined) | TTTGAATACTCATTCACGGGAATT |
| GenBank Accession | ED595156 [GenBank] |
| Graphic View | 
|
| Predicted Position of Insertion | Chr5:5523642 - go to primer design |
| BLAST e Value | 4e-06 |
| Hit Clone Code (BAC ID) | F5E19 |
| Hit Gene Code | At5g16790 [Araport] [TAIR] [MIPS] [SIGnAL] |
| Gene Annotation | Tho complex subunit 7/Mft1p |
| Insertion Classification | TS2TE (5') |
| Confirmation Status | confirmed, show confirmation sequences |
| Primer and wt-amplicons | show primer details |
|
Last Updated on Thursday, 10 June 2021 13:37 |
gabi-kat.de 