DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_066961
Line Availability available from NASC (N566961) and ABRC (SALK_066961)
Confirmed for Hit At5g67230
Parent of DUPLO pair 2248
Parent of pair(s) none

Gene hit At5g67230

 
Sequence (A. th genome BLAST matches underlined)
TTGAATCTCCTCGACAAGCTCCTTACTATGCGTATTGCTATCATCAGC
GenBank Accession BH911199 [GenBank]
Graphic View Graphic view of gene At5g67230
Predicted Position of Insertion Chr5:26823403 - go to primer design
BLAST e Value 5e-08
Hit Clone Code (BAC ID) K21H1
Hit Gene Code At5g67230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-diphospho-sugar transferases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37