DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_067094c
Line Availability available from NASC (N670886) and ABRC (SALK_067094c)
Confirmed for Hit At3g21310
Parent of DUPLO pair none
Parent of pair(s) 2614, 93866, 93872, 93880, 93884

Gene hit At3g21310

 
Sequence (A. th genome BLAST matches underlined) 
TTGCCAGATGATAGATCAGATTTCCCGAGCTCGTCTGTGTTGTACTGAAGACAGATCCCA
AGTCAGGTACTTTTGTTGATCAATGGATGATTGCTGCTTCGTGAGTCTTGATTTGG
GenBank Accession ED596113 [GenBank]
Graphic View Graphic view of gene At3g21310
Predicted Position of Insertion Chr3:7498221 - go to primer design
BLAST e Value 2e-31
Hit Clone Code (BAC ID) MXL8
Hit Gene Code At3g21310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Core-2/I-branching beta-1,6-N-acetylglucosaminyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37