DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_067236c
Line Availability available from NASC (N681224) and ABRC (SALK_067236c)
Confirmed for Hit At2g34440
Parent of DUPLO pair 6867
Parent of pair(s) none

Gene hit At2g34440

 
Sequence (A. th genome BLAST matches underlined)
CCTACCATGGACTGTCTGAAGCCTATCTTTGTATTCATTGAGTTCATCGAGGGTAAGCGT
CTCAATGGACTCCTTGAATCTCTCATCCACAGGCAGATTCAAGCT
GenBank Accession ED596217 [GenBank]
Graphic View Graphic view of gene At2g34440
Predicted Position of Insertion Chr2:14527405 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 29
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37