DUPLOdb - Line and FST details


Line specific information

 
Line ID SALK_067559c
Line Availability available from NASC (N666317) and ABRC (SALK_067559c)
Confirmed for Hit At4g25620
Parent of DUPLO pair 2337
Parent of pair(s) none

Gene hit At4g25620

 
Sequence (A. th genome BLAST matches underlined)
TCCGATCGAATTTTCTCTATCATCTCTTCATTGGTGCTATCAAACTTGAATT
GenBank Accession BH848142 [GenBank]
Graphic View Graphic view of gene At4g25620
Predicted Position of Insertion Chr4:13067541 - go to primer design
BLAST e Value 3e-22
Hit Clone Code (BAC ID) M7J2
Hit Gene Code At4g25620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hydroxyproline-rich glycoprotein family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on Thursday, 10 June 2021 13:37